Pyrimidine salvage is catalysed by thymidine kinase.

On the other hand, one can select for the presence of active salvage enzymes. The best example is the use of "HAT medium" in somatic cell genetic analysis and in preparing monoclonal antibodies. These techniques involve fusing cells of different origins and culturing in HAT medium to select for those cells that have undergone fusion. HAT is an acronym for the medium’s constituents,— hypoxanthine, aminopterin, and thymidine. Aminopterin inhibits dihydrofolate reductase, blocking the synthesis of tetrahydrofolate needed for de novo synthesis of purine nucleotides and thymidine nucleotides. Thus, cells can grow in HAT medium only if they express active thymidine kinase and HGPRT, for salvage synthesis of thymidine and purine nucleotides, respectively. In monoclonal antibody production, one of the cell lines to be fused lacks thymidine kinase, and the other lacks HGPRT. Thus, only cells resulting from a fusion event have functional copies of both enzymes and can grow.

Deficiency of APRT leads to renal calculi.

The major pathway for the catabolism of guanine nucleotides begins with a dephosphorylation reaction that yields guanosine. Guanosine deaminase then catalyzes the conversion of guanosine to xanthosine, which is further catabolized to xanthine by purine nucleosidase (). Hypoxanthine and/or xanthine are converted to uricate by xanthine oxidoreductase. There are two forms of xanthine oxidoreductase. One form has a requirement for molecular oxygen and is called xanthine oxidase (EC 1.2.3.2). The other form, xanthine dehydrogenase (EC 1.2.1.37), is an NAD-dependent enzyme. In higher plants, oxidation of hypoxanthine and xanthine seems to be catalyzed by xanthine dehydrogenase, although the two forms of xanthine oxidoreductase may be interconverted (see ). Allopurinol (4-hydroxypyrazolo(3,4-d)pyrimidine), a specific inhibitor of xanthine oxidoreductase () is often used as an inhibitor of purine catabolism in studies with higher plants (; ; ).


Deficiency of HGPRT is the cause of Lesch–Nyhan disease.

The end products of purine catabolism are different in different species. For example, uric acid is the end product of higher primates including man, however, allantoin is formed in other mammals (). In most plants, purine nucleotides are degraded via ureides, allantoin and allantoate to NH3 and CO2 by the conventional purine catabolic pathway (). In specific organs (e.g., roots) of ureide-accumulating plants, allantoin and/or allantoate are the end products of this pathway and they are translocated to other parts of the plant, such as shoots and leaves, where they are degraded completely. So, in contrast to biosynthesis of purine nucleotides, catabolism of purines is diversified in different species and organs. Furthermore, various enzymes that participate in each step of catabolism exist in nature, and some enzymes commonly found in animals are missing in plants. A typical example is ADA, which is widely distributed in animals, but this enzyme is not present in most plants. In some bacteria, Ade deaminase can participate in the deamination of Ade ring (see ). There is no research on the purine catabolic pathway in A. thaliana and only a few putative genes encoding the enzymes of purine catabolism have been characterized.


while nucleosides are anabolized primarily by kinases.

HIV-2 TAR RNA (5′ GGCCAGAUUGAGCCUGGGAGCUCUCUGGCC3′) was synthesized by in vitro transcription with T7 RNA polymerase using a mixture of unlabeled UTP and CTP from Sigma and 13C2,8-ATP and U-15N-GTP. RNA was synthesized in a 20 mL reaction under optimized conditions: 21 mM total NTP’s (5.25 mM each), 40 mM Tris HCl (pH 8.1), 0.1 mM spermidine, 10 mM DTT, 28 mM MgCl2, 0.001% Triton X-100, 80 mg/mL polyethylene glycol (8000 MW), 300 nM each DNA strand (Invitrogen), and 0.65 mg/mL T7 RNA polymerase, incubated at 37°C for 4 hours. The RNA was purified on denaturing 20% polyacrylamide gels, electro-eluted and desalted, lyophilized and diluted in 10 mM sodium phosphate (pH 6.5), 150 mM NaCl, 10% D2O for recording NMR spectra.

Formation of Deoxyribonucleotides

ADK and SAH hydrolase transcript levels and activities increase when methylation demand increases, such as in plants that accumulate methylated osmolytes in response to salinity stress or in lignifying cells (). This suggests that although ADK is a housekeeping enzyme, its level of expression is dynamic so as to meet changes in methylation activity and maintain methyl recycling. The direct correlation between the level of pectin methylation and ADK activity in the ADK-deficient lines indicates that ADK has become limiting for methyl recycling activity in these plants.

Table 1. Properties of the Human Deoxyribonucleoside Kinases

ADK-deficient lines created by sense and antisense silencing have wavy leaves and short internodes and stamen filaments (BA Moffatt, Y Stevens, M Allen, J Snider, PS Summers, EA Weretilnyk, L Martin-McCaffrey, LA Pereira, M Todorova, C Wagner, unpublished). This phenotype is similar to that of tobacco lines deficient in SAH hydrolase activity (). In both cases, there is reduction in SAM-dependent methylation: ADK-deficient plants have less methylated pectin in their seed mucilage and SAH hydrolase-deficient lines have less methylated DNA. The current hypothesis to explain the phenotype of the ADK lines is that reduced Ado recycling leads to Ado inhibition of SAH hydrolase activity and SAH accumulation, ultimately causing inhibition of SAM-dependent transmethylation activities.